# Loading genome files

We can install a genome to GenIE-Sys using either Graphical User Interface (GUI) or Command Line Interface (CLI).

{% tabs %}
{% tab title="Using Graphical User Interface (GUI)" %}
Once you have placed all the required files into the data folder according to the previous section ([Input files](https://geniesys.gitbook.io/geniesys/for-administrators/input-files)). You will be able to see the annotation tab similar to the following screenshot.

![Annotation tab in the admin panel of the GenIE-Sys website](/files/-MK_AOvESRD-3CFtK24P)

If you miss some of the files described in the previous section, you will be able to see the error message similar to the following screenshot.

![](/files/-MK_AhkJzduVn0ODYkvC)

Please make sure to place the correct files into the data folder. Once you have placed all required files, now it's time to parse them into the suitable formats right before loading into the database. Please follow the order in the Annotation tab, first load data into the database and then create BLAST indices using Generate FASTA indices link.

{% hint style="warning" %}
If you have expression data please go to the next tab otherwise please log out from the site and see all your changes are displayed on the GeneList, BLAST and gene information pages.
{% endhint %}
{% endtab %}

{% tab title="Using Command Line Interface (CLI) " %}
Creating a new database using CMD

Due to the increasing number of species in PlantGenIE we use a standard naming convention to easily identify and maintain the databases. For example: `[website name]_[species name]_[version number]`

![](/files/-MJmukZTTG63uH55bZsg)

Log into the MySQL server and create a database.

```
CREATE DATABASE new_database;
```

You can download the empty database [here](https://raw.githubusercontent.com/irusri/scripts/master/dump.sql). Then load the database into the newly created database using the following commands.

```
git show HEAD~1:scripts/dump.sql > dump.sql
mysql -u newuser -p newpassword new_database < dump.sql
```

Log into the MySQL server to create user and grant permissions.

`Create MySQL user`

```
CREATE USER newuser@'localhost' IDENTIFIED BY 'newpassword';
```

`User permissions`

```
GRANT SELECT ON new_database.* TO newuser@'localhost';
GRANT INSERT,UPDATE,DELETE ON new_database.genebaskets TO newuser@'localhost';
GRANT INSERT,UPDATE,DELETE ON new_database.defaultgenebaskets TO newuser@'localhost';
```

`newuser, newpassword and new_database` should be included in the plugins/settings.php similar to following example.

```
//Define the databasename names
$db_species_array=array("new_database"=>"new genome",...
//Define the databasename and background colours
$db_species_color_array=array("new_database"=>"#86c0a6",....
//Define the username, password and host here
$db_url=  array ('genelist'=>'mysqli://newuser:newpassword@localhost/'.$selected_database); 
//Define the base url with trailing slash
$GLOBALS["base_url"]='http://localhost:3000/';
```

### Download

Let’s assume we need to integrate Populus tremula v2.0 genome into GenIE-System. First, we need to download the required files. The latest version of the GFF3 and FASTA files are available on [PlantGenIE FTP](ftp://plantgenie.org/Data/PopGenIE/Populus_tremula/).

```
curl -O ftp://plantgenie.org/Data/PopGenIE/Populus_tremula/v2.2/gff/Potra02_genes.gff.gz
curl -O ftp://plantgenie.org/Data/PopGenIE/Populus_tremula/v2.2/fasta/Potra02_genome.fasta.gz
gzip -d Potra02_genes.gff.gz
gzip -d Potra02_genome.fasta.gz

awk '!/##/' Potra02_genes.gff  |head
chr1	maker	gene	8865	11259	.	-	.	ID=Potra2n1c1;Name=Potra2n1c1
chr1	maker	mRNA	8865	10802	.	-	.	ID=Potra2n1c1.3;Parent=Potra2n1c1;Name=Potra2n1c1.3;_AED=0.39;_eAED=0.37;_QI=192|0.66|0.75|1|0|0|4|0|115
chr1	maker	CDS	8865	9054	.	-	1	ID=Potra2n1c1.3:cds;Parent=Potra2n1c1.3
chr1	maker	CDS	9487	9559	.	-	2	ID=Potra2n1c1.3:cds;Parent=Potra2n1c1.3
chr1	maker	CDS	9669	9753	.	-	0	ID=Potra2n1c1.3:cds;Parent=Potra2n1c1.3
chr1	maker	exon	9669	9764	.	-	.	ID=Potra2n1c1.3:exon:300;Parent=Potra2n1c1.3
chr1	maker	five_prime_UTR	9754	9764	.	-	.	ID=Potra2n1c1.3:five_prime_utr;Parent=Potra2n1c1.3
chr1	maker	exon	10622	10802	.	-	.	ID=Potra2n1c1.3:exon:299;Parent=Potra2n1c1.3
chr1	maker	five_prime_UTR	10622	10802	.	-	.	ID=Potra2n1c1.3:five_prime_utr;Parent=Potra2n1c1.3
chr1	maker	mRNA	8865	11259	.	-	.	ID=Potra2n1c1.1;Parent=Potra2n1c1;Name=Potra2n1c1.1;_AED=0.22;_eAED=0.21;_QI=896|0.66|0.75|1|0|0|4|0|115

head Potra02_genome.fasta
>chr1
AGAGAGCTCTGTGGGTCATTACTGTCACAACTCCTAGCCAGCTTGAATAT
TCCATATAGCACATATCCTGGATGGGAAAGTTTGGTTAATGTGTGCTATT
CTTGCTCGCCTTCAACACGATTATTTCGTTCATACCACAAGAAATAAACA
GTAGTGGATAGTAGAAGGCGAGCTAGCATGTGATCACTGTTATTCTTCTT
CGTGTAGTGAGTGACTGACCAATGAAGCAATTGTGTCCACGGTTTGCATG
GCCAATAATGGTTGGCTCTGCGACAAATGGACTTCCAAACCAAGCTGGTG
TAACTGCATTCAAAAAAGAGGTGTTCATATGTTTCCATGTAAATTCCATA
TAGTATGCAAGTTGTATCTGTGACTCCTCCATGCAATCTATCCATCGTTC
TTAGTCTACCAAGGCTGGCTAACCAGAGTATAAATGAGTGACGAGGGATA
```

### Parse genome

Now we need to parse GFF3 and FASTA files into required formats. There are two primary tables(transcript\_info and gene\_info) in the database.

```
## generate file for gene_info table
awk '/gene/{split($9,a,"ID=");split(a[2],b,";");print b[1],$1,$4,$5,$7}' FS='\t' OFS='\t' Potra02_genes.gff > gene_info.txt
$ head gene_info.txt
Potra2n1c1	chr1	8865	11259	-
Potra2n1c2	chr1	21121	21603	+
Potra2n1c3	chr1	22295	24697	-
Potra2n1c4	chr1	30731	32811	+
Potra2n1c5	chr1	33508	33833	+
Potra2n1c6	chr1	50823	54726	-
Potra2n1c7	chr1	50901	51116	+
Potra2n1c8	chr1	54928	62450	-
Potra2n1c9	chr1	69471	73884	-
Potra2n1c10	chr1	74717	75583	+

## create file for transcript_info table
awk 'BEGIN{ OFS = "\t"; }$3~/gene/{g=$4"\t"$5}$3~/RNA$/{split($9,a,/[;=]/);for(i=1;i in a;i+=2)k[a[i]]=a[i+1]; print k["Name"], k["Parent"], "desc", $1, $7, g, "PAC", "PEP", $4,$5}' Potra02_genes.gff > transcript_info.txt
$ head transcript_info.txt
Potra2n1c1.3	Potra2n1c1	desc	chr1	-	8865	11259	PAC	PEP	8865	10802
Potra2n1c1.1	Potra2n1c1	desc	chr1	-	8865	11259	PAC	PEP	8865	11259
Potra2n1c1.2	Potra2n1c1	desc	chr1	-	8865	11259	PAC	PEP	8865	11259
Potra2n1c2.1	Potra2n1c2	desc	chr1	+	21121	21603	PAC	PEP	21121	21603
Potra2n1c3.1	Potra2n1c3	desc	chr1	-	22295	24697	PAC	PEP	22295	24697
Potra2n1c4.1	Potra2n1c4	desc	chr1	+	30731	32811	PAC	PEP	30731	32811
Potra2n1c5.1	Potra2n1c5	desc	chr1	+	33508	33833	PAC	PEP	33508	33833
Potra2n1c6.1	Potra2n1c6	desc	chr1	-	50823	54726	PAC	PEP	50823	54726
Potra2n1c7.1	Potra2n1c7	desc	chr1	+	50901	51116	PAC	PEP	50901	51116
Potra2n1c8.3	Potra2n1c8	desc	chr1	-	54928	62450	PAC	PEP	54928	61609
```

### Create a database

Now we need to create a database. To do this, you need a MySQL username and password. If you use the MAMP installation default username and password would be `root`.

```
## Download all required scripts and dump database
$ git clone https://github.com/irusri/scripts.git
## Create database for default root user and root password
$ mysql -u root -proot
mysql> create database my_genie_sys_database;
Query OK, 1 row affected (0.01 sec)
mysql> use my_genie_sys_database;
Database changed
mysql> source scripts/dump.sql;
```

### Loading primary tables

Now we need to load above two files(gene\_info.txt and transcript\_info.txt) into the newly created database. There is a script(`load_data.sh`) to do this. We can download the script and enter the correct `username, password and database` information to `DB_USER, DB_PASS and DB` parameters respectively.

```
$ nano scripts/load_data.sh
#load_data.sh script
#!/bin/bash
#load_data.sh
#USAGE: sh load_data.sh [table_name] [filename]
#sh load_data.sh transcript_info_x /tmp/transcript_info.tsv

DB_USER='root' #'your_db_username'
DB_PASS='root' #'your_password'
DB='my_genie_sys_database' #'database_name'

mysql  --host=localhost --user=$DB_USER --password=$DB_PASS --local_infile=1 --database=$DB <<EOFMYSQL
TRUNCATE TABLE $1;
ALTER TABLE $1 AUTO_INCREMENT = 1;
load data local infile '$2' ignore INTO TABLE $1 CHARACTER SET UTF8 fields terminated by '\t' LINES TERMINATED BY '\n' ignore 0 lines;
EOFMYSQL
```

Run following commands to load `gene_info.txt` and `transcript_info.txt` into respective tables.

```
#Load above generated source file into gene_info table
sh scripts/load_data.sh gene_info gene_info.txt

#Load previously generated source file into transcript_info table
sh scripts/load_data.sh transcript_info transcript_info.txt
```

Now we need to update the `gene_i` parameter in `transcript_info` table. There is a script(`update_gene_i.sh`) in the scripts directory, we just need to enter the correct `username, password and database` information to `DB_USER, DB_PASS and DB` parameters respectively as we did in previous step.

```
$ nano scripts/update_gene_i.sh
#update_gene_i.sh script
#!/bin/bash
#update_gene_i.sh

DB_USER='root' #'your_db_username'
DB_PASS='root' #'your_password'
DB='my_genie_sys_database' #'database_name'

#USAGE: sh update_gene_i.sh

mysql --host=localhost --user=$DB_USER --password=$DB_PASS --local_infile=1 --database=$DB <<EOFMYSQL
create temporary table add_gene_i(gene_i MEDIUMINT NOT NULL AUTO_INCREMENT PRIMARY KEY, genename VARCHAR(40));
ALTER TABLE add_gene_i AUTO_INCREMENT = 1;
INSERT INTO add_gene_i(genename) select DISTINCT(gene_id) from transcript_info;
UPDATE transcript_info INNER join add_gene_i ON add_gene_i.genename = transcript_info.gene_id SET transcript_info.gene_i = add_gene_i.gene_i;
drop temporary table add_gene_i;
EOFMYSQL
```

Let’s run the following command to update `gene_i` in `transcript_info` table.

```
#Finally update the gene_i in transcript_info table using update_gene_i.sh.
sh scripts/update_gene_i.sh
```

If above script takes time please try following command on MySQL. This will update the `gene_i` column in `transcript_info` table.

```
$ nano scripts/update_gene_i.sh
#update_gene_i_dev.sh script
#!/bin/bash
#update_gene_i_dev.sh

DB_USER='root' #'your_db_username'
DB_PASS='root' #'your_password'
DB='my_genie_sys_database' #'database_name'

#USAGE: sh update_gene_i_dev.sh

mysql --host=localhost --user=$DB_USER --password=$DB_PASS --local_infile=1 --database=$DB <<EOFMYSQL
update transcript_info,gene_info set transcript_info.gene_i=gene_info.gene_i where gene_info.gene_id=transcript_info.gene_id;
EOFMYSQL
```

Run following command to execute the above script(`update_gene_i_dev.sh`)

```
sh scripts/update_gene_i_dev.sh
```

Great! We have loaded transcript and gene infortmation properly into the database. Now can we load additional information. For example; description to the `transcript_info` table.

```
$ curl -O ftp://plantgenie.org/Data/PopGenIE/Populus_tremula/v2.2/annotation/blast2go/Potra22_blast2go_description.txt
$ head Potra22_blast2go_description.txt
Potra2n765s36715.1	UniRef90_B9GWJ3F-box domain-containing protein n=2 Tax=Populus TaxID=3689 RepID=B9GWJ3_POPTR
Potra2n765s36713.1	Populus trichocarpa uncharacterized LOC112326797 (LOC112326797), ncRNA
Potra2n765s36713.2	Populus trichocarpa uncharacterized LOC112326797 (LOC112326797), ncRNA
Potra2n765s36714.1	UniRef90_A0A2K2BA33FAD-binding PCMH-type domain-containing protein n=40 Tax=Populus TaxID=3689 RepID=A0A2K2BA33_POPTR
Potra2n1433s37070.1	UniRef90_U7E173Protein kinase domain-containing protein (Fragment) n=1 Tax=Populus trichocarpa TaxID=3694 RepID=U7E173_POPTR
Potra2n581s36023.1	UniRef90_UPI00057ABC08probable LRR receptor-like serine/threonine-protein kinase At4g08850 isoform X1 n=1 Tax=Populus euphratica TaxID=75702 RepID=UPI00057ABC08
Potra2n581s36025.1	UniRef90_UPI00057B3C83probable LRR receptor-like serine/threonine-protein kinase At4g08850 n=1 Tax=Populus euphratica TaxID=75702 RepID=UPI00057B3C83
Potra2n581s36024.1	UniRef90_U5GE99Zeta-carotene desaturase n=10 Tax=fabids TaxID=91835 RepID=U5GE99_POPTR
Potra2n707s36547.1	UniRef90_A0A2K1X8T3AMPKBI domain-containing protein n=5 Tax=Populus TaxID=3689 RepID=A0A2K1X8T3_POPTR
Potra2n409s35556.1	UniRef90_UPI000B5D6D9FE3 ubiquitin-protein ligase SHPRH isoform X3 n=1 Tax=Manihot esculenta TaxID=3983 RepID=UPI000B5D6D9F
```

Here is the script to load `description` into `transcript_info` column.

```
#!/bin/bash
#update_description.sh

DB_USER='root' #'your_db_username'
DB_PASS='root' #'your_password'
DB='my_genie_sys_database' #'database_name'

# if less than two arguments supplied, display  error message
        if [  $# -le 0 ]
        then
                start='\033[0;33m'
                start_0='\033[0;33m'
                start_2='\033[0;31m'
                end='\033[0m'
                echo  "\nUsage:\n$0 ${start}[gene_info/transcript_info] [file_name]${end}\nEx: ${start_2}sh update_description.sh transcript_info/gene_info potra_description.tsv${end}\n\nWhat it does?\n${start_0}This script will create a two columns(ids, description) temporary table and load the [file_name] into it.\nThen it will match ids column in temporary table with transcript_ids/gene_ids and update the gene/transcript description.\nFinally delete the temporary table.\n${end}"
                exit 1
        fi

table_name=$(echo $1 | awk '{split($0,a,"_");print a[1]}');
tmp_field_name=$table_name"_id"
/usr/bin/mysql --host=localhost --user=$DB_USER --password=$DB_PASS --local_infile=1 --database=$DB<<EOFMYSQL
CREATE TEMPORARY TABLE tmp_tb(gene_name VARCHAR(60),annotation VARCHAR(1000));
load data local infile '$2' replace INTO TABLE tmp_tb fields terminated by '\t' LINES TERMINATED BY '\n' ignore 0 lines;
UPDATE $1 INNER JOIN tmp_tb on tmp_tb.gene_name = $1.$tmp_field_name SET $1.description = tmp_tb.annotation;
DROP TEMPORARY TABLE tmp_tb;
EOFMYSQL
```

We just need to run the script to load `description` into `transcript_info` table.

```
sh scripts/update_description.sh transcript_info Potra22_blast2go_description.txt
```

### Loading secondary tables

Following are the tables available with GenIE-Sys default database. However, it is easy to add more tables depending on the user demands. Secondary table conatins annotation related to the primary tables.

```
$ curl -O ftp://plantgenie.org/Data/PopGenIE/Populus_tremula/v2.2/annotation/blast2go/Potra22_blast2go_GO.txt
$ head Potra22_blast2go_GO.txt
Sequence Name	Annotation GO ID-Annotation GO Term
Potra2n765s36715.1	GO:0005515-protein binding
Potra2n765s36714.1	GO:0009690-cytokinin metabolic process
Potra2n765s36714.1	GO:0016021-integral component of membrane
Potra2n765s36714.1	GO:0019139-cytokinin dehydrogenase activity
Potra2n765s36714.1	GO:0055114-oxidation-reduction process
Potra2n765s36714.1	GO:0071949-FAD binding
Potra2n1433s37070.1	GO:0004674-protein serine/threonine kinase activity
Potra2n1433s37070.1	GO:0005509-calcium ion binding
Potra2n1433s37070.1	GO:0005524-ATP binding

$ awk 'BEGIN{FS="\t";OFS="\t"}{a[$1]=a[$1]?a[$1]";"$2:$2;}END{for (i in a)print i"\t"a[i];}'   Potra22_blast2go_GO.txt > Potrav22_go_desc.txt
$ head Potrav22_go_desc.txt
Potra2n5c11384.4	GO:0019904-protein domain specific binding
Potra2n1c2900.1	GO:0006118-obsolete electron transport;GO:0009055-electron transfer activity;GO:0016021-integral component of membrane;GO:0022900-electron transport chain
Potra2n12c24161.1	GO:0005789-endoplasmic reticulum membrane;GO:0016021-integral component of membrane
Potra2n6c13118.1	GO:0003677-DNA binding;GO:0004724-magnesium-dependent protein serine/threonine phosphatase activity;GO:0005963-magnesium-dependent protein serine/threonine phosphatase complex;GO:0006470-protein dephosphorylation;GO:0046872-metal ion binding
Potra2n6c13118.2	GO:0003677-DNA binding;GO:0004724-magnesium-dependent protein serine/threonine phosphatase activity;GO:0005963-magnesium-dependent protein serine/threonine phosphatase complex;GO:0006470-protein dephosphorylation;GO:0046872-metal ion binding
Potra2n6c13118.3	GO:0003677-DNA binding;GO:0004724-magnesium-dependent protein serine/threonine phosphatase activity;GO:0005963-magnesium-dependent protein serine/threonine phosphatase complex;GO:0006470-protein dephosphorylation;GO:0046872-metal ion binding
Potra2n9c19679.1	GO:0016021-integral component of membrane;GO:0016117-carotenoid biosynthetic process;GO:0016166-phytoene dehydrogenase activity;GO:0016757-transferase activity, transferring glycosyl groups;GO:0055114-oxidation-reduction process
Potra2n14c27340.1	GO:0046872-metal ion binding
Potra2n9c19679.2	GO:0016021-integral component of membrane;GO:0016117-carotenoid biosynthetic process;GO:0016166-phytoene dehydrogenase activity;GO:0016757-transferase activity, transferring glycosyl groups;GO:0055114-oxidation-reduction process
Potra2n14c27340.2	GO:0046872-metal ion binding
```

As you see the annotation are based on transcript IDs. Therefore, Following script can be used to load secondary table into `transcript_go` table. Then update `transcript_i` column using another script as described below.

```
sh scripts/load_data.sh transcript_go Potrav22_go_desc.txt
```

Then update the `gene_i` or `transcript_i` depending on the primary usint of the annotation dataset using following script.

```
#!/bin/bash
#update_annotation_gene.sh

DB_USER='root' #'your_db_username'
DB_PASS='root' #'your_password'
DB='my_genie_sys_database' #'database_name'

#USAGE sh update_annotation_gene_i.sh transcript_go
display_usage() {
        echo  "\nUsage:\n$0 [table_name] \n"
        }

# if less than one arguments supplied, display usage
        if [  $# -le 0 ]
        then
                display_usage
                exit 1
        fi

count=$(mysql --host=localhost --user=$DB_USER --password=$DB_PASS --database=$DB -sse "SHOW COLUMNS FROM $1 LIKE 'transcript_id';")
if [ ${#count} -gt 0 ]
then
     mysql --host=localhost --user=$DB_USER --password=$DB_PASS --local_infile=1 --database=$DB <<EOFMYSQL
UPDATE $1 INNER JOIN transcript_info on transcript_info.transcript_id = $1.transcript_id SET $1.transcript_i = transcript_info.transcript_i;
EOFMYSQL
else
     mysql --host=localhost --user=$DB_USER --password=$DB_PASS --local_infile=1 --database=$DB <<EOFMYSQL
UPDATE $1 INNER JOIN transcript_info on transcript_info.gene_id = $1.gene_id SET $1.gene_i = transcript_info.gene_i;
EOFMYSQL
fi
```

Let’s run following command to fill the `transcript_i` or `gene_i` column.

```
sh scripts/update_annotation_gene_i.sh transcript_go
```

Similalrly when we have annotation based on gene IDs, we have to fill gene\_`annotation` tables.

You may also load additional annotation as secondary tables to the GenIE-Sys database. If there is a transcript-based annotation, please use the following script to create a corresponding table (please replace `annotation` with the name of the annotation).

```
-- ----------------------------
--  Table structure for `transcript_annotation`
-- ----------------------------
DROP TABLE IF EXISTS `transcript_annotation`;
CREATE TABLE `transcript_annotation` (
  `transcript_id` varchar(255) NOT NULL,
  `annotation_description` varchar(1000)  DEFAULT '' NOT NULL,
  `transcript_i` mediumint(20) unsigned DEFAULT 0 NOT NULL,
  PRIMARY KEY (`transcript_i`,`transcript_id`),
) ENGINE=MyISAM DEFAULT CHARSET=latin1 ROW_FORMAT=COMPACT;
```

If there is a gene-based annotation, please use the following script to create a corresponding table (please replace `annotation` with the name of the annotation).

```
-- ----------------------------
--  Table structure for `gene_annotation`
-- ----------------------------
DROP TABLE IF EXISTS `gene_annotation`;
CREATE TABLE `gene_annotation` (
  `gene_id` varchar(255) NOT NULL,
  `annotation_description` varchar(1000)  DEFAULT '' NOT NULL,
  `gene_i` mediumint(20) unsigned DEFAULT 0 NOT NULL,
  PRIMARY KEY (`gene_i`,`gene_id`),
) ENGINE=MyISAM DEFAULT CHARSET=latin1 ROW_FORMAT=COMPACT;
```

Finally you may need to add the new annotation into `/plugins/genelist/genelist/service/config.php` to make it searchable in the GeneSearch tool.
{% endtab %}
{% endtabs %}

###


---

# Agent Instructions: Querying This Documentation

If you need additional information that is not directly available in this page, you can query the documentation dynamically by asking a question.

Perform an HTTP GET request on the current page URL with the `ask` query parameter:

```
GET https://geniesys.gitbook.io/geniesys/for-administrators/loading-genome-files.md?ask=<question>
```

The question should be specific, self-contained, and written in natural language.
The response will contain a direct answer to the question and relevant excerpts and sources from the documentation.

Use this mechanism when the answer is not explicitly present in the current page, you need clarification or additional context, or you want to retrieve related documentation sections.
