We can install a genome to GenIE-Sys using either Graphical User Interface (GUI) or Command Line Interface (CLI).
Once you have placed all the required files into the data folder according to the previous section (Input files). You will be able to see the annotation tab similar to the following screenshot.
If you miss some of the files described in the previous section, you will be able to see the error message similar to the following screenshot.
Please make sure to place the correct files into the data folder. Once you have placed all required files, now it's time to parse them into the suitable formats right before loading into the database. Please follow the order in the Annotation tab, first load data into the database and then create BLAST indices using Generate FASTA indices link.
If you have expression data please go to the next tab otherwise please log out from the site and see all your changes are displayed on the GeneList, BLAST and gene information pages.
Creating a new database using CMD
Due to the increasing number of species in PlantGenIE we use a standard naming convention to easily identify and maintain the databases. For example: [website name]_[species name]_[version number]
Log into the MySQL server and create a database.
CREATE DATABASE new_database;
You can download the empty database here. Then load the database into the newly created database using the following commands.
git show HEAD~1:scripts/dump.sql > dump.sqlmysql -u newuser -p newpassword new_database < dump.sql
Log into the MySQL server to create user and grant permissions.
Create MySQL user
CREATE USER [email protected]'localhost' IDENTIFIED BY 'newpassword';
User permissions
GRANT SELECT ON new_database.* TO [email protected]'localhost';GRANT INSERT,UPDATE,DELETE ON new_database.genebaskets TO [email protected]'localhost';GRANT INSERT,UPDATE,DELETE ON new_database.defaultgenebaskets TO [email protected]'localhost';
newuser, newpassword and new_database
should be included in the plugins/settings.php similar to following example.
//Define the databasename names$db_species_array=array("new_database"=>"new genome",...//Define the databasename and background colours$db_species_color_array=array("new_database"=>"#86c0a6",....//Define the username, password and host here$db_url= array ('genelist'=>'mysqli://newuser:[email protected]/'.$selected_database);//Define the base url with trailing slash$GLOBALS["base_url"]='http://localhost:3000/';
Let’s assume we need to integrate Populus tremula v2.0 genome into GenIE-System. First, we need to download the required files. The latest version of the GFF3 and FASTA files are available on PlantGenIE FTP.
curl -O ftp://plantgenie.org/Data/PopGenIE/Populus_tremula/v2.2/gff/Potra02_genes.gff.gzcurl -O ftp://plantgenie.org/Data/PopGenIE/Populus_tremula/v2.2/fasta/Potra02_genome.fasta.gzgzip -d Potra02_genes.gff.gzgzip -d Potra02_genome.fasta.gzawk '!/##/' Potra02_genes.gff |headchr1 maker gene 8865 11259 . - . ID=Potra2n1c1;Name=Potra2n1c1chr1 maker mRNA 8865 10802 . - . ID=Potra2n1c1.3;Parent=Potra2n1c1;Name=Potra2n1c1.3;_AED=0.39;_eAED=0.37;_QI=192|0.66|0.75|1|0|0|4|0|115chr1 maker CDS 8865 9054 . - 1 ID=Potra2n1c1.3:cds;Parent=Potra2n1c1.3chr1 maker CDS 9487 9559 . - 2 ID=Potra2n1c1.3:cds;Parent=Potra2n1c1.3chr1 maker CDS 9669 9753 . - 0 ID=Potra2n1c1.3:cds;Parent=Potra2n1c1.3chr1 maker exon 9669 9764 . - . ID=Potra2n1c1.3:exon:300;Parent=Potra2n1c1.3chr1 maker five_prime_UTR 9754 9764 . - . ID=Potra2n1c1.3:five_prime_utr;Parent=Potra2n1c1.3chr1 maker exon 10622 10802 . - . ID=Potra2n1c1.3:exon:299;Parent=Potra2n1c1.3chr1 maker five_prime_UTR 10622 10802 . - . ID=Potra2n1c1.3:five_prime_utr;Parent=Potra2n1c1.3chr1 maker mRNA 8865 11259 . - . ID=Potra2n1c1.1;Parent=Potra2n1c1;Name=Potra2n1c1.1;_AED=0.22;_eAED=0.21;_QI=896|0.66|0.75|1|0|0|4|0|115head Potra02_genome.fasta>chr1AGAGAGCTCTGTGGGTCATTACTGTCACAACTCCTAGCCAGCTTGAATATTCCATATAGCACATATCCTGGATGGGAAAGTTTGGTTAATGTGTGCTATTCTTGCTCGCCTTCAACACGATTATTTCGTTCATACCACAAGAAATAAACAGTAGTGGATAGTAGAAGGCGAGCTAGCATGTGATCACTGTTATTCTTCTTCGTGTAGTGAGTGACTGACCAATGAAGCAATTGTGTCCACGGTTTGCATGGCCAATAATGGTTGGCTCTGCGACAAATGGACTTCCAAACCAAGCTGGTGTAACTGCATTCAAAAAAGAGGTGTTCATATGTTTCCATGTAAATTCCATATAGTATGCAAGTTGTATCTGTGACTCCTCCATGCAATCTATCCATCGTTCTTAGTCTACCAAGGCTGGCTAACCAGAGTATAAATGAGTGACGAGGGATA
Now we need to parse GFF3 and FASTA files into required formats. There are two primary tables(transcript_info and gene_info) in the database.
## generate file for gene_info tableawk '/gene/{split($9,a,"ID=");split(a[2],b,";");print b[1],$1,$4,$5,$7}' FS='\t' OFS='\t' Potra02_genes.gff > gene_info.txt$ head gene_info.txtPotra2n1c1 chr1 8865 11259 -Potra2n1c2 chr1 21121 21603 +Potra2n1c3 chr1 22295 24697 -Potra2n1c4 chr1 30731 32811 +Potra2n1c5 chr1 33508 33833 +Potra2n1c6 chr1 50823 54726 -Potra2n1c7 chr1 50901 51116 +Potra2n1c8 chr1 54928 62450 -Potra2n1c9 chr1 69471 73884 -Potra2n1c10 chr1 74717 75583 +## create file for transcript_info tableawk 'BEGIN{ OFS = "\t"; }$3~/gene/{g=$4"\t"$5}$3~/RNA$/{split($9,a,/[;=]/);for(i=1;i in a;i+=2)k[a[i]]=a[i+1]; print k["Name"], k["Parent"], "desc", $1, $7, g, "PAC", "PEP", $4,$5}' Potra02_genes.gff > transcript_info.txt$ head transcript_info.txtPotra2n1c1.3 Potra2n1c1 desc chr1 - 8865 11259 PAC PEP 8865 10802Potra2n1c1.1 Potra2n1c1 desc chr1 - 8865 11259 PAC PEP 8865 11259Potra2n1c1.2 Potra2n1c1 desc chr1 - 8865 11259 PAC PEP 8865 11259Potra2n1c2.1 Potra2n1c2 desc chr1 + 21121 21603 PAC PEP 21121 21603Potra2n1c3.1 Potra2n1c3 desc chr1 - 22295 24697 PAC PEP 22295 24697Potra2n1c4.1 Potra2n1c4 desc chr1 + 30731 32811 PAC PEP 30731 32811Potra2n1c5.1 Potra2n1c5 desc chr1 + 33508 33833 PAC PEP 33508 33833Potra2n1c6.1 Potra2n1c6 desc chr1 - 50823 54726 PAC PEP 50823 54726Potra2n1c7.1 Potra2n1c7 desc chr1 + 50901 51116 PAC PEP 50901 51116Potra2n1c8.3 Potra2n1c8 desc chr1 - 54928 62450 PAC PEP 54928 61609
Now we need to create a database. To do this, you need a MySQL username and password. If you use the MAMP installation default username and password would be root
.
## Download all required scripts and dump database$ git clone https://github.com/irusri/scripts.git## Create database for default root user and root password$ mysql -u root -prootmysql> create database my_genie_sys_database;Query OK, 1 row affected (0.01 sec)mysql> use my_genie_sys_database;Database changedmysql> source scripts/dump.sql;
Now we need to load above two files(gene_info.txt and transcript_info.txt) into the newly created database. There is a script(load_data.sh
) to do this. We can download the script and enter the correct username, password and database
information to DB_USER, DB_PASS and DB
parameters respectively.
$ nano scripts/load_data.sh#load_data.sh script#!/bin/bash#load_data.sh#USAGE: sh load_data.sh [table_name] [filename]#sh load_data.sh transcript_info_x /tmp/transcript_info.tsvDB_USER='root' #'your_db_username'DB_PASS='root' #'your_password'DB='my_genie_sys_database' #'database_name'mysql --host=localhost --user=$DB_USER --password=$DB_PASS --local_infile=1 --database=$DB <<EOFMYSQLTRUNCATE TABLE $1;ALTER TABLE $1 AUTO_INCREMENT = 1;load data local infile '$2' ignore INTO TABLE $1 CHARACTER SET UTF8 fields terminated by '\t' LINES TERMINATED BY '\n' ignore 0 lines;EOFMYSQL
Run following commands to load gene_info.txt
and transcript_info.txt
into respective tables.
#Load above generated source file into gene_info tablesh scripts/load_data.sh gene_info gene_info.txt#Load previously generated source file into transcript_info tablesh scripts/load_data.sh transcript_info transcript_info.txt
Now we need to update the gene_i
parameter in transcript_info
table. There is a script(update_gene_i.sh
) in the scripts directory, we just need to enter the correct username, password and database
information to DB_USER, DB_PASS and DB
parameters respectively as we did in previous step.
$ nano scripts/update_gene_i.sh#update_gene_i.sh script#!/bin/bash#update_gene_i.shDB_USER='root' #'your_db_username'DB_PASS='root' #'your_password'DB='my_genie_sys_database' #'database_name'#USAGE: sh update_gene_i.shmysql --host=localhost --user=$DB_USER --password=$DB_PASS --local_infile=1 --database=$DB <<EOFMYSQLcreate temporary table add_gene_i(gene_i MEDIUMINT NOT NULL AUTO_INCREMENT PRIMARY KEY, genename VARCHAR(40));ALTER TABLE add_gene_i AUTO_INCREMENT = 1;INSERT INTO add_gene_i(genename) select DISTINCT(gene_id) from transcript_info;UPDATE transcript_info INNER join add_gene_i ON add_gene_i.genename = transcript_info.gene_id SET transcript_info.gene_i = add_gene_i.gene_i;drop temporary table add_gene_i;EOFMYSQL
Let’s run the following command to update gene_i
in transcript_info
table.
#Finally update the gene_i in transcript_info table using update_gene_i.sh.sh scripts/update_gene_i.sh
If above script takes time please try following command on MySQL. This will update the gene_i
column in transcript_info
table.
$ nano scripts/update_gene_i.sh#update_gene_i_dev.sh script#!/bin/bash#update_gene_i_dev.shDB_USER='root' #'your_db_username'DB_PASS='root' #'your_password'DB='my_genie_sys_database' #'database_name'#USAGE: sh update_gene_i_dev.shmysql --host=localhost --user=$DB_USER --password=$DB_PASS --local_infile=1 --database=$DB <<EOFMYSQLupdate transcript_info,gene_info set transcript_info.gene_i=gene_info.gene_i where gene_info.gene_id=transcript_info.gene_id;EOFMYSQL
Run following command to execute the above script(update_gene_i_dev.sh
)
sh scripts/update_gene_i_dev.sh
Great! We have loaded transcript and gene infortmation properly into the database. Now can we load additional information. For example; description to the transcript_info
table.
$ curl -O ftp://plantgenie.org/Data/PopGenIE/Populus_tremula/v2.2/annotation/blast2go/Potra22_blast2go_description.txt$ head Potra22_blast2go_description.txtPotra2n765s36715.1 UniRef90_B9GWJ3F-box domain-containing protein n=2 Tax=Populus TaxID=3689 RepID=B9GWJ3_POPTRPotra2n765s36713.1 Populus trichocarpa uncharacterized LOC112326797 (LOC112326797), ncRNAPotra2n765s36713.2 Populus trichocarpa uncharacterized LOC112326797 (LOC112326797), ncRNAPotra2n765s36714.1 UniRef90_A0A2K2BA33FAD-binding PCMH-type domain-containing protein n=40 Tax=Populus TaxID=3689 RepID=A0A2K2BA33_POPTRPotra2n1433s37070.1 UniRef90_U7E173Protein kinase domain-containing protein (Fragment) n=1 Tax=Populus trichocarpa TaxID=3694 RepID=U7E173_POPTRPotra2n581s36023.1 UniRef90_UPI00057ABC08probable LRR receptor-like serine/threonine-protein kinase At4g08850 isoform X1 n=1 Tax=Populus euphratica TaxID=75702 RepID=UPI00057ABC08Potra2n581s36025.1 UniRef90_UPI00057B3C83probable LRR receptor-like serine/threonine-protein kinase At4g08850 n=1 Tax=Populus euphratica TaxID=75702 RepID=UPI00057B3C83Potra2n581s36024.1 UniRef90_U5GE99Zeta-carotene desaturase n=10 Tax=fabids TaxID=91835 RepID=U5GE99_POPTRPotra2n707s36547.1 UniRef90_A0A2K1X8T3AMPKBI domain-containing protein n=5 Tax=Populus TaxID=3689 RepID=A0A2K1X8T3_POPTRPotra2n409s35556.1 UniRef90_UPI000B5D6D9FE3 ubiquitin-protein ligase SHPRH isoform X3 n=1 Tax=Manihot esculenta TaxID=3983 RepID=UPI000B5D6D9F
Here is the script to load description
into transcript_info
column.
#!/bin/bash#update_description.shDB_USER='root' #'your_db_username'DB_PASS='root' #'your_password'DB='my_genie_sys_database' #'database_name'# if less than two arguments supplied, display error messageif [ $# -le 0 ]thenstart='\033[0;33m'start_0='\033[0;33m'start_2='\033[0;31m'end='\033[0m'echo "\nUsage:\n$0 ${start}[gene_info/transcript_info] [file_name]${end}\nEx: ${start_2}sh update_description.sh transcript_info/gene_info potra_description.tsv${end}\n\nWhat it does?\n${start_0}This script will create a two columns(ids, description) temporary table and load the [file_name] into it.\nThen it will match ids column in temporary table with transcript_ids/gene_ids and update the gene/transcript description.\nFinally delete the temporary table.\n${end}"exit 1fitable_name=$(echo $1 | awk '{split($0,a,"_");print a[1]}');tmp_field_name=$table_name"_id"/usr/bin/mysql --host=localhost --user=$DB_USER --password=$DB_PASS --local_infile=1 --database=$DB<<EOFMYSQLCREATE TEMPORARY TABLE tmp_tb(gene_name VARCHAR(60),annotation VARCHAR(1000));load data local infile '$2' replace INTO TABLE tmp_tb fields terminated by '\t' LINES TERMINATED BY '\n' ignore 0 lines;UPDATE $1 INNER JOIN tmp_tb on tmp_tb.gene_name = $1.$tmp_field_name SET $1.description = tmp_tb.annotation;DROP TEMPORARY TABLE tmp_tb;EOFMYSQL
We just need to run the script to load description
into transcript_info
table.
sh scripts/update_description.sh transcript_info Potra22_blast2go_description.txt
Following are the tables available with GenIE-Sys default database. However, it is easy to add more tables depending on the user demands. Secondary table conatins annotation related to the primary tables.
$ curl -O ftp://plantgenie.org/Data/PopGenIE/Populus_tremula/v2.2/annotation/blast2go/Potra22_blast2go_GO.txt$ head Potra22_blast2go_GO.txtSequence Name Annotation GO ID-Annotation GO TermPotra2n765s36715.1 GO:0005515-protein bindingPotra2n765s36714.1 GO:0009690-cytokinin metabolic processPotra2n765s36714.1 GO:0016021-integral component of membranePotra2n765s36714.1 GO:0019139-cytokinin dehydrogenase activityPotra2n765s36714.1 GO:0055114-oxidation-reduction processPotra2n765s36714.1 GO:0071949-FAD bindingPotra2n1433s37070.1 GO:0004674-protein serine/threonine kinase activityPotra2n1433s37070.1 GO:0005509-calcium ion bindingPotra2n1433s37070.1 GO:0005524-ATP binding$ awk 'BEGIN{FS="\t";OFS="\t"}{a[$1]=a[$1]?a[$1]";"$2:$2;}END{for (i in a)print i"\t"a[i];}' Potra22_blast2go_GO.txt > Potrav22_go_desc.txt$ head Potrav22_go_desc.txtPotra2n5c11384.4 GO:0019904-protein domain specific bindingPotra2n1c2900.1 GO:0006118-obsolete electron transport;GO:0009055-electron transfer activity;GO:0016021-integral component of membrane;GO:0022900-electron transport chainPotra2n12c24161.1 GO:0005789-endoplasmic reticulum membrane;GO:0016021-integral component of membranePotra2n6c13118.1 GO:0003677-DNA binding;GO:0004724-magnesium-dependent protein serine/threonine phosphatase activity;GO:0005963-magnesium-dependent protein serine/threonine phosphatase complex;GO:0006470-protein dephosphorylation;GO:0046872-metal ion bindingPotra2n6c13118.2 GO:0003677-DNA binding;GO:0004724-magnesium-dependent protein serine/threonine phosphatase activity;GO:0005963-magnesium-dependent protein serine/threonine phosphatase complex;GO:0006470-protein dephosphorylation;GO:0046872-metal ion bindingPotra2n6c13118.3 GO:0003677-DNA binding;GO:0004724-magnesium-dependent protein serine/threonine phosphatase activity;GO:0005963-magnesium-dependent protein serine/threonine phosphatase complex;GO:0006470-protein dephosphorylation;GO:0046872-metal ion bindingPotra2n9c19679.1 GO:0016021-integral component of membrane;GO:0016117-carotenoid biosynthetic process;GO:0016166-phytoene dehydrogenase activity;GO:0016757-transferase activity, transferring glycosyl groups;GO:0055114-oxidation-reduction processPotra2n14c27340.1 GO:0046872-metal ion bindingPotra2n9c19679.2 GO:0016021-integral component of membrane;GO:0016117-carotenoid biosynthetic process;GO:0016166-phytoene dehydrogenase activity;GO:0016757-transferase activity, transferring glycosyl groups;GO:0055114-oxidation-reduction processPotra2n14c27340.2 GO:0046872-metal ion binding
As you see the annotation are based on transcript IDs. Therefore, Following script can be used to load secondary table into transcript_go
table. Then update transcript_i
column using another script as described below.
sh scripts/load_data.sh transcript_go Potrav22_go_desc.txt
Then update the gene_i
or transcript_i
depending on the primary usint of the annotation dataset using following script.
#!/bin/bash#update_annotation_gene.shDB_USER='root' #'your_db_username'DB_PASS='root' #'your_password'DB='my_genie_sys_database' #'database_name'#USAGE sh update_annotation_gene_i.sh transcript_godisplay_usage() {echo "\nUsage:\n$0 [table_name] \n"}# if less than one arguments supplied, display usageif [ $# -le 0 ]thendisplay_usageexit 1ficount=$(mysql --host=localhost --user=$DB_USER --password=$DB_PASS --database=$DB -sse "SHOW COLUMNS FROM $1 LIKE 'transcript_id';")if [ ${#count} -gt 0 ]thenmysql --host=localhost --user=$DB_USER --password=$DB_PASS --local_infile=1 --database=$DB <<EOFMYSQLUPDATE $1 INNER JOIN transcript_info on transcript_info.transcript_id = $1.transcript_id SET $1.transcript_i = transcript_info.transcript_i;EOFMYSQLelsemysql --host=localhost --user=$DB_USER --password=$DB_PASS --local_infile=1 --database=$DB <<EOFMYSQLUPDATE $1 INNER JOIN transcript_info on transcript_info.gene_id = $1.gene_id SET $1.gene_i = transcript_info.gene_i;EOFMYSQLfi
Let’s run following command to fill the transcript_i
or gene_i
column.
sh scripts/update_annotation_gene_i.sh transcript_go
Similalrly when we have annotation based on gene IDs, we have to fill gene_annotation
tables.
You may also load additional annotation as secondary tables to the GenIE-Sys database. If there is a transcript-based annotation, please use the following script to create a corresponding table (please replace annotation
with the name of the annotation).
-- ------------------------------ Table structure for `transcript_annotation`-- ----------------------------DROP TABLE IF EXISTS `transcript_annotation`;CREATE TABLE `transcript_annotation` (`transcript_id` varchar(255) NOT NULL,`annotation_description` varchar(1000) DEFAULT '' NOT NULL,`transcript_i` mediumint(20) unsigned DEFAULT 0 NOT NULL,PRIMARY KEY (`transcript_i`,`transcript_id`),) ENGINE=MyISAM DEFAULT CHARSET=latin1 ROW_FORMAT=COMPACT;
If there is a gene-based annotation, please use the following script to create a corresponding table (please replace annotation
with the name of the annotation).
-- ------------------------------ Table structure for `gene_annotation`-- ----------------------------DROP TABLE IF EXISTS `gene_annotation`;CREATE TABLE `gene_annotation` (`gene_id` varchar(255) NOT NULL,`annotation_description` varchar(1000) DEFAULT '' NOT NULL,`gene_i` mediumint(20) unsigned DEFAULT 0 NOT NULL,PRIMARY KEY (`gene_i`,`gene_id`),) ENGINE=MyISAM DEFAULT CHARSET=latin1 ROW_FORMAT=COMPACT;
Finally you may need to add the new annotation into /plugins/genelist/genelist/service/config.php
to make it searchable in the GeneSearch tool.